Transcript: Human NM_001311199.1

Homo sapiens chloride nucleotide-sensitive channel 1A (CLNS1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
CLNS1A (1207)
Length:
976
CDS:
93..806

Additional Resources:

NCBI RefSeq record:
NM_001311199.1
NBCI Gene record:
CLNS1A (1207)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001311199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338251 CACCTATGAAGAAGGATTATC pLKO_005 596 CDS 100% 13.200 9.240 N CLNS1A n/a
2 TRCN0000005256 GCCACACTGGAGAGATTAGAA pLKO.1 639 CDS 100% 5.625 3.938 N CLNS1A n/a
3 TRCN0000338196 GCCACACTGGAGAGATTAGAA pLKO_005 639 CDS 100% 5.625 3.938 N CLNS1A n/a
4 TRCN0000005258 CCAACAGTTGCTGGACAGTTT pLKO.1 762 CDS 100% 4.950 3.465 N CLNS1A n/a
5 TRCN0000338197 CCAACAGTTGCTGGACAGTTT pLKO_005 762 CDS 100% 4.950 3.465 N CLNS1A n/a
6 TRCN0000069523 GATTAGGATTCTCACTGGAAT pLKO.1 244 CDS 100% 4.950 3.465 N Clns1a n/a
7 TRCN0000005257 GCATTTGTATGTTATGGTGAA pLKO.1 320 CDS 100% 4.050 2.835 N CLNS1A n/a
8 TRCN0000005255 GCCTAGTGATAAATCAGCGTT pLKO.1 437 CDS 100% 2.640 1.848 N CLNS1A n/a
9 TRCN0000368935 ATGATGATGTTGAACCTATTA pLKO_005 400 CDS 100% 13.200 7.920 N CLNS1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.