Transcript: Mouse NM_001312644.1

Mus musculus tetratricopeptide repeat domain 6 (Ttc6), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Ttc6 (70846)
Length:
5901
CDS:
144..5717

Additional Resources:

NCBI RefSeq record:
NM_001312644.1
NBCI Gene record:
Ttc6 (70846)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001312644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267269 CCGACTTTGAAGGCACGTTAT pLKO_005 273 CDS 100% 10.800 15.120 N Ttc6 n/a
2 TRCN0000267272 AGACCATCAAGGAGCTTATTC pLKO_005 955 CDS 100% 13.200 9.240 N Ttc6 n/a
3 TRCN0000267271 CATCGCAATGGAAGATATTTC pLKO_005 1001 CDS 100% 13.200 9.240 N Ttc6 n/a
4 TRCN0000267270 CTAACCAGCCAGCCAACTTTA pLKO_005 1317 CDS 100% 13.200 9.240 N Ttc6 n/a
5 TRCN0000267268 TCCAGCCTGAGCAGCGATATT pLKO_005 723 CDS 100% 13.200 9.240 N Ttc6 n/a
6 TRCN0000147365 GATTATGGAATTGTGCTGCTT pLKO.1 4635 CDS 100% 2.640 1.848 N TTC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001312644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.