Transcript: Mouse NM_001312880.1

Mus musculus glyoxylate reductase/hydroxypyruvate reductase (Grhpr), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Grhpr (76238)
Length:
1280
CDS:
493..1044

Additional Resources:

NCBI RefSeq record:
NM_001312880.1
NBCI Gene record:
Grhpr (76238)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001312880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042333 CCATTCGGTGTCCAGAGATTT pLKO.1 577 CDS 100% 13.200 18.480 N Grhpr n/a
2 TRCN0000232694 CCATTCGGTGTCCAGAGATTT pLKO_005 577 CDS 100% 13.200 18.480 N GRHPR n/a
3 TRCN0000351551 CCATTCGGTGTCCAGAGATTT pLKO_005 577 CDS 100% 13.200 18.480 N Grhpr n/a
4 TRCN0000042337 GCCCAGCGAACTCAAGCTGTA pLKO.1 1023 CDS 100% 1.350 1.080 N Grhpr n/a
5 TRCN0000042336 CCACTTGGCTTTGGATGAAAT pLKO.1 315 5UTR 100% 13.200 9.240 N Grhpr n/a
6 TRCN0000232693 CCACTTGGCTTTGGATGAAAT pLKO_005 315 5UTR 100% 13.200 9.240 N GRHPR n/a
7 TRCN0000334920 CCACTTGGCTTTGGATGAAAT pLKO_005 315 5UTR 100% 13.200 9.240 N Grhpr n/a
8 TRCN0000042334 GCCGAGTTTCAGGCAGAGTTT pLKO.1 634 CDS 100% 4.950 3.465 N Grhpr n/a
9 TRCN0000351425 GCCGAGTTTCAGGCAGAGTTT pLKO_005 634 CDS 100% 4.950 3.465 N Grhpr n/a
10 TRCN0000042335 GTGGACAAGAAACTTCTGGAT pLKO.1 245 5UTR 100% 2.640 1.848 N Grhpr n/a
11 TRCN0000334840 GTGGACAAGAAACTTCTGGAT pLKO_005 245 5UTR 100% 2.640 1.848 N Grhpr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001312880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.