Transcript: Mouse NM_001312903.1

Mus musculus patched 2 (Ptch2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ptch2 (19207)
Length:
5114
CDS:
1262..3844

Additional Resources:

NCBI RefSeq record:
NM_001312903.1
NBCI Gene record:
Ptch2 (19207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001312903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088373 CGCTATCAGTTTGCACCTTTA pLKO.1 2312 CDS 100% 10.800 15.120 N Ptch2 n/a
2 TRCN0000088374 CGAGCTTACTTCCAAGGTCTA pLKO.1 409 5UTR 100% 4.050 3.240 N Ptch2 n/a
3 TRCN0000230024 TGCCAGTAAAGTCCAAGTATC pLKO_005 723 5UTR 100% 10.800 7.560 N PTCH2 n/a
4 TRCN0000088377 CGGATGATTGAGAAGCTGTTT pLKO.1 823 5UTR 100% 4.950 3.465 N Ptch2 n/a
5 TRCN0000088375 GCTCTTTGGTATCATGGGATT pLKO.1 3301 CDS 100% 4.050 2.835 N Ptch2 n/a
6 TRCN0000088376 GCTGTAATTGAGACAGACCTA pLKO.1 526 5UTR 100% 2.640 1.848 N Ptch2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001312903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.