Transcript: Mouse NM_001313762.1

Mus musculus CDK5 regulatory subunit associated protein 2 (Cdk5rap2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cdk5rap2 (214444)
Length:
11433
CDS:
581..5230

Additional Resources:

NCBI RefSeq record:
NM_001313762.1
NBCI Gene record:
Cdk5rap2 (214444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313762.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183538 GCCATCAAGATACGATTCATT pLKO.1 3490 CDS 100% 5.625 7.875 N Cdk5rap2 n/a
2 TRCN0000346858 GCCATCAAGATACGATTCATT pLKO_005 3490 CDS 100% 5.625 7.875 N Cdk5rap2 n/a
3 TRCN0000183731 CCTCAAGACTTACTAATGGAA pLKO.1 3953 CDS 100% 3.000 4.200 N Cdk5rap2 n/a
4 TRCN0000346798 CCTCAAGACTTACTAATGGAA pLKO_005 3953 CDS 100% 3.000 4.200 N Cdk5rap2 n/a
5 TRCN0000195952 CGTGAGATCATGGAGGACTAT pLKO.1 1934 CDS 100% 4.950 3.465 N Cdk5rap2 n/a
6 TRCN0000346857 CGTGAGATCATGGAGGACTAT pLKO_005 1934 CDS 100% 4.950 3.465 N Cdk5rap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313762.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.