Transcript: Mouse NM_001313890.1

Mus musculus interleukin 7 (Il7), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Il7 (16196)
Length:
2884
CDS:
731..1072

Additional Resources:

NCBI RefSeq record:
NM_001313890.1
NBCI Gene record:
Il7 (16196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067605 CTGATAGTAATTGCCCGAATA pLKO.1 768 CDS 100% 10.800 15.120 N Il7 n/a
2 TRCN0000318173 CTGATAGTAATTGCCCGAATA pLKO_005 768 CDS 100% 10.800 15.120 N Il7 n/a
3 TRCN0000067603 GCTCGCAAGTTGAAGCAATTT pLKO.1 857 CDS 100% 13.200 9.240 N Il7 n/a
4 TRCN0000318098 GCTCGCAAGTTGAAGCAATTT pLKO_005 857 CDS 100% 13.200 9.240 N Il7 n/a
5 TRCN0000067604 GCATGTTTCCTAAAGAGACTA pLKO.1 1001 CDS 100% 4.950 3.465 N Il7 n/a
6 TRCN0000318175 GCATGTTTCCTAAAGAGACTA pLKO_005 1001 CDS 100% 4.950 3.465 N Il7 n/a
7 TRCN0000067606 GAAGAATTCAATGTCCACTTA pLKO.1 896 CDS 100% 0.000 0.000 N Il7 n/a
8 TRCN0000067607 GAGTGCCACATTAAAGACAAA pLKO.1 683 5UTR 100% 4.950 2.970 N Il7 n/a
9 TRCN0000318172 GAGTGCCACATTAAAGACAAA pLKO_005 683 5UTR 100% 4.950 2.970 N Il7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.