Transcript: Human NM_001313999.1

Homo sapiens beclin 1 (BECN1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BECN1 (8678)
Length:
1840
CDS:
3..1070

Additional Resources:

NCBI RefSeq record:
NM_001313999.1
NBCI Gene record:
BECN1 (8678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001313999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033549 CCCGTGGAATGGAATGAGATT pLKO.1 891 CDS 100% 4.950 6.930 N BECN1 n/a
2 TRCN0000299864 CCCGTGGAATGGAATGAGATT pLKO_005 891 CDS 100% 4.950 6.930 N BECN1 n/a
3 TRCN0000033553 GCTTGGGTGTCCTCACAATTT pLKO.1 1180 3UTR 100% 13.200 9.240 N BECN1 n/a
4 TRCN0000299863 GCTTGGGTGTCCTCACAATTT pLKO_005 1180 3UTR 100% 13.200 9.240 N BECN1 n/a
5 TRCN0000033552 CTCAAGTTCATGCTGACGAAT pLKO.1 1144 3UTR 100% 4.950 3.465 N BECN1 n/a
6 TRCN0000299789 CTCAAGTTCATGCTGACGAAT pLKO_005 1144 3UTR 100% 4.950 3.465 N BECN1 n/a
7 TRCN0000033551 GCCAGGATGATGTCCACAGAA pLKO.1 258 CDS 100% 4.950 3.465 N BECN1 n/a
8 TRCN0000299790 GCCAGGATGATGTCCACAGAA pLKO_005 258 CDS 100% 4.950 3.465 N BECN1 n/a
9 TRCN0000033550 CCGACTTGTTCCTTACGGAAA pLKO.1 986 CDS 100% 4.050 2.835 N BECN1 n/a
10 TRCN0000310521 CCGACTTGTTCCTTACGGAAA pLKO_005 986 CDS 100% 4.050 2.835 N BECN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.