Transcript: Human NM_001315529.2

Homo sapiens pericentrin (PCNT), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PCNT (5116)
Length:
10706
CDS:
845..10264

Additional Resources:

NCBI RefSeq record:
NM_001315529.2
NBCI Gene record:
PCNT (5116)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001315529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161774 CGGCAGATAGACAAGTGTTAA pLKO.1 5145 CDS 100% 13.200 18.480 N PCNT n/a
2 TRCN0000278205 CGGCAGATAGACAAGTGTTAA pLKO_005 5145 CDS 100% 13.200 18.480 N PCNT n/a
3 TRCN0000163483 GCAGACTGTAGTGCGAGATTT pLKO.1 8296 CDS 100% 13.200 18.480 N PCNT n/a
4 TRCN0000297404 GCAGACTGTAGTGCGAGATTT pLKO_005 8296 CDS 100% 13.200 18.480 N PCNT n/a
5 TRCN0000162596 CGTAAAGAGATCACCGAGAAA pLKO.1 3113 CDS 100% 4.950 6.930 N PCNT n/a
6 TRCN0000278206 CGTAAAGAGATCACCGAGAAA pLKO_005 3113 CDS 100% 4.950 6.930 N PCNT n/a
7 TRCN0000159669 GCGACAATTCTATTTGAGGAA pLKO.1 10288 3UTR 100% 2.640 3.696 N PCNT n/a
8 TRCN0000160525 CGACAATTCTATTTGAGGAAA pLKO.1 10289 3UTR 100% 4.950 3.465 N PCNT n/a
9 TRCN0000162774 CGAGCAGACTTTGAGGAACAA pLKO.1 3470 CDS 100% 4.950 3.465 N PCNT n/a
10 TRCN0000162298 CGTGTCTAAGCTTGAGAAGTT pLKO.1 9469 CDS 100% 4.950 3.465 N PCNT n/a
11 TRCN0000297405 CGTGTCTAAGCTTGAGAAGTT pLKO_005 9469 CDS 100% 4.950 3.465 N PCNT n/a
12 TRCN0000159086 GAATTAAGTGTCCTCACCTTT pLKO.1 10399 3UTR 100% 4.950 3.465 N PCNT n/a
13 TRCN0000162995 GCAGCATGAAACTCGTCTGAA pLKO.1 2608 CDS 100% 4.950 3.465 N PCNT n/a
14 TRCN0000162352 CAGAAGCAAGTCAATGACCAT pLKO.1 806 5UTR 100% 2.640 1.848 N PCNT n/a
15 TRCN0000278207 CAGAAGCAAGTCAATGACCAT pLKO_005 806 5UTR 100% 2.640 1.848 N PCNT n/a
16 TRCN0000162140 CCAGATAGTAAAGACCCTGAA pLKO.1 1510 CDS 100% 4.050 2.430 N PCNT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001315529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.