Transcript: Human NM_001316335.2

Homo sapiens proline rich and Gla domain 2 (PRRG2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
PRRG2 (5639)
Length:
1570
CDS:
416..955

Additional Resources:

NCBI RefSeq record:
NM_001316335.2
NBCI Gene record:
PRRG2 (5639)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056460 CCTGGATACTTCACCCAGTGA pLKO.1 230 5UTR 100% 2.640 3.696 N PRRG2 n/a
2 TRCN0000432301 ATTCATACCGGATTCCGGAAG pLKO_005 997 3UTR 100% 2.250 3.150 N PRRG2 n/a
3 TRCN0000056461 CCGGGCTCATTAGCCCTCTGA pLKO.1 786 CDS 100% 0.000 0.000 N PRRG2 n/a
4 TRCN0000419136 ATCTTGTGTATGGGCAGATAT pLKO_005 1278 3UTR 100% 13.200 10.560 N PRRG2 n/a
5 TRCN0000056462 ACAGGTGGCATCCTGCTCATT pLKO.1 689 CDS 100% 4.950 3.465 N PRRG2 n/a
6 TRCN0000056459 AGCTACATCTACAATGGCAAA pLKO.1 623 CDS 100% 4.050 2.835 N PRRG2 n/a
7 TRCN0000056458 AGTGTCTGGAAGAGAGGTGTT pLKO.1 543 CDS 100% 4.050 2.430 N PRRG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.