Transcript: Human NM_001316349.2

Homo sapiens thrombospondin type 1 domain containing 7B (THSD7B), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
THSD7B (80731)
Length:
6112
CDS:
179..4999

Additional Resources:

NCBI RefSeq record:
NM_001316349.2
NBCI Gene record:
THSD7B (80731)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245697 AGCGTTCAGATGGCGTTAATG pLKO_005 4527 CDS 100% 13.200 18.480 N THSD7B n/a
2 TRCN0000245696 ATGAGCCGGACTCGATTTATC pLKO_005 3983 CDS 100% 13.200 18.480 N THSD7B n/a
3 TRCN0000092520 CCGGACTCGATTTATCATTAT pLKO.1 3988 CDS 100% 13.200 18.480 N Thsd7b n/a
4 TRCN0000245700 ACATGGAGTCAAGGATTATTA pLKO_005 5154 3UTR 100% 15.000 10.500 N THSD7B n/a
5 TRCN0000245699 GGAATGCCCAGATACCTTATA pLKO_005 2509 CDS 100% 13.200 9.240 N THSD7B n/a
6 TRCN0000245698 TGATCCAGATGGCCGAGTAAA pLKO_005 4822 CDS 100% 13.200 9.240 N THSD7B n/a
7 TRCN0000092521 GCATAGTATCTTCCTGGTCAA pLKO.1 1632 CDS 100% 4.050 3.240 N Thsd7b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.