Transcript: Mouse NM_001316372.1

Mus musculus phosphatidylcholine transfer protein (Pctp), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pctp (18559)
Length:
2776
CDS:
53..658

Additional Resources:

NCBI RefSeq record:
NM_001316372.1
NBCI Gene record:
Pctp (18559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001316372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105219 ACATGGACTTAGACTACAGAA pLKO.1 267 CDS 100% 4.950 3.465 N Pctp n/a
2 TRCN0000105217 CATCCGAGTGAAACAGTACAA pLKO.1 499 CDS 100% 4.950 3.465 N Pctp n/a
3 TRCN0000105216 CTGGGAAGTGAAGTACCCTTT pLKO.1 352 CDS 100% 4.050 2.835 N Pctp n/a
4 TRCN0000105218 TGTGAAAGAACTCTACGAGAA pLKO.1 304 CDS 100% 4.050 2.835 N Pctp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.