Transcript: Mouse NM_001316674.1

Mus musculus sphingosine phosphate lyase 1 (Sgpl1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Sgpl1 (20397)
Length:
4059
CDS:
117..1823

Additional Resources:

NCBI RefSeq record:
NM_001316674.1
NBCI Gene record:
Sgpl1 (20397)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001316674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176195 GAAGGACTTCGAGCCTTATTT pLKO.1 143 CDS 100% 15.000 10.500 N Sgpl1 n/a
2 TRCN0000319808 GAAGGACTTCGAGCCTTATTT pLKO_005 143 CDS 100% 15.000 10.500 N Sgpl1 n/a
3 TRCN0000174945 GCACAATAGGATAAACCATAA pLKO.1 1925 3UTR 100% 10.800 7.560 N Sgpl1 n/a
4 TRCN0000319875 GCACAATAGGATAAACCATAA pLKO_005 1925 3UTR 100% 10.800 7.560 N Sgpl1 n/a
5 TRCN0000193584 GCATCGTCTTTACTTAATCAT pLKO.1 2092 3UTR 100% 5.625 3.375 N Sgpl1 n/a
6 TRCN0000350190 GCATCGTCTTTACTTAATCAT pLKO_005 2092 3UTR 100% 5.625 3.375 N Sgpl1 n/a
7 TRCN0000173916 GATCGAACAACAGGTGAGCAA pLKO.1 377 CDS 100% 2.640 1.584 N Sgpl1 n/a
8 TRCN0000319874 GATCGAACAACAGGTGAGCAA pLKO_005 377 CDS 100% 2.640 1.584 N Sgpl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.