Transcript: Mouse NM_001316713.1

Mus musculus Rho GTPase activating protein 17 (Arhgap17), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Arhgap17 (70497)
Length:
3470
CDS:
847..2445

Additional Resources:

NCBI RefSeq record:
NM_001316713.1
NBCI Gene record:
Arhgap17 (70497)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001316713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112877 CCACCATTCACATAAGCGTTT pLKO.1 238 5UTR 100% 4.050 5.670 N Arhgap17 n/a
2 TRCN0000317849 CCACCATTCACATAAGCGTTT pLKO_005 238 5UTR 100% 4.050 5.670 N Arhgap17 n/a
3 TRCN0000112878 CCCAGACCAGTGACGTTAATA pLKO.1 1184 CDS 100% 15.000 10.500 N Arhgap17 n/a
4 TRCN0000317850 CCCAGACCAGTGACGTTAATA pLKO_005 1184 CDS 100% 15.000 10.500 N Arhgap17 n/a
5 TRCN0000112875 GCCAGAATATGGAGAGAAATA pLKO.1 3187 3UTR 100% 13.200 9.240 N Arhgap17 n/a
6 TRCN0000112879 CCAAGCAGAATCCATCGCAAA pLKO.1 2258 CDS 100% 4.050 2.835 N Arhgap17 n/a
7 TRCN0000319597 TACCGACAGCAGGAGTATTAC pLKO_005 2871 3UTR 100% 0.000 0.000 N Arhgap17 n/a
8 TRCN0000319598 CTGGACACTGTGCGTTCAATG pLKO_005 215 5UTR 100% 10.800 6.480 N Arhgap17 n/a
9 TRCN0000112876 GCTCTTGAACTCTCACAACAT pLKO.1 422 5UTR 100% 4.950 2.970 N Arhgap17 n/a
10 TRCN0000158276 CAGCAACAACAGCAGCAACAA pLKO.1 2062 CDS 100% 4.950 2.475 Y RBMS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.