Transcript: Mouse NM_001316716.1

Mus musculus D-aspartate oxidase (Ddo), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ddo (70503)
Length:
944
CDS:
85..588

Additional Resources:

NCBI RefSeq record:
NM_001316716.1
NBCI Gene record:
Ddo (70503)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001316716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246354 CCACACAGAAGCGATGGTTTA pLKO_005 296 CDS 100% 10.800 15.120 N Ddo n/a
2 TRCN0000246357 GTAGCGGCTGGGATGCTTATT pLKO_005 220 CDS 100% 13.200 10.560 N Ddo n/a
3 TRCN0000202244 GCGATGGTTTAGAGAGACCTT pLKO.1 306 CDS 100% 2.640 2.112 N Ddo n/a
4 TRCN0000246355 TGTCTACTGCAGCATGCATTT pLKO_005 131 CDS 100% 10.800 7.560 N Ddo n/a
5 TRCN0000189898 GCATGCATTTCCCAACTGGTT pLKO.1 142 CDS 100% 2.640 1.848 N Ddo n/a
6 TRCN0000217357 GTATCTGGTTGGCAGATATTC pLKO.1 385 CDS 100% 1.320 0.924 N Ddo n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.