Transcript: Mouse NM_001316723.1

Mus musculus cadherin 4 (Cdh4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cdh4 (12561)
Length:
1416
CDS:
192..1196

Additional Resources:

NCBI RefSeq record:
NM_001316723.1
NBCI Gene record:
Cdh4 (12561)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001316723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435779 TCAGGATCAGGTCGGACAAAG pLKO_005 754 CDS 100% 10.800 8.640 N Cdh4 n/a
2 TRCN0000094730 GCACACTCTGAACACAAGAAA pLKO.1 570 CDS 100% 5.625 3.938 N Cdh4 n/a
3 TRCN0000094732 CGTCATTGACATGAACGACAA pLKO.1 980 CDS 100% 4.050 2.835 N Cdh4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.