Transcript: Human NM_001316952.2

Homo sapiens GPALPP motifs containing 1 (GPALPP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
GPALPP1 (55425)
Length:
5695
CDS:
608..1261

Additional Resources:

NCBI RefSeq record:
NM_001316952.2
NBCI Gene record:
GPALPP1 (55425)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264350 ATACCATTTGACCGTGATAAA pLKO_005 1133 CDS 100% 13.200 18.480 N Gpalpp1 n/a
2 TRCN0000134800 CTCAAGGTTAATCGGTTTGAT pLKO.1 1157 CDS 100% 5.625 7.875 N GPALPP1 n/a
3 TRCN0000134564 GATCTCAAGGTTAATCGGTTT pLKO.1 1154 CDS 100% 4.050 5.670 N GPALPP1 n/a
4 TRCN0000134582 GAATACCATTTGACCGTGATA pLKO.1 1131 CDS 100% 4.950 3.960 N GPALPP1 n/a
5 TRCN0000216626 GATAAAGATCTCAAGGTTAAT pLKO.1 1148 CDS 100% 13.200 9.240 N Gpalpp1 n/a
6 TRCN0000416813 TCACACGGCAAAGGCAATATG pLKO_005 1232 CDS 100% 13.200 9.240 N GPALPP1 n/a
7 TRCN0000425277 ACATCTGGAGATCGATCAATC pLKO_005 884 CDS 100% 10.800 7.560 N GPALPP1 n/a
8 TRCN0000133765 CCTCCAGAAATGAAAGACTTT pLKO.1 824 CDS 100% 4.950 3.465 N GPALPP1 n/a
9 TRCN0000136486 CAGGATGATGACGATGATGAT pLKO.1 355 5UTR 100% 4.950 2.970 N GPALPP1 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3239 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 2855 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3239 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.