Transcript: Mouse NM_001317124.1

Mus musculus histamine receptor H1 (Hrh1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Hrh1 (15465)
Length:
3605
CDS:
67..1533

Additional Resources:

NCBI RefSeq record:
NM_001317124.1
NBCI Gene record:
Hrh1 (15465)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001317124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219101 ATCTGTCCAAACGAGATATTT pLKO_005 2727 3UTR 100% 15.000 21.000 N Hrh1 n/a
2 TRCN0000229453 GTGGTGGTTCTAAGTAGTATC pLKO_005 157 CDS 100% 10.800 15.120 N Hrh1 n/a
3 TRCN0000028729 GATTCCCTATTTCATCTTCTT pLKO.1 1353 CDS 100% 4.950 3.960 N Hrh1 n/a
4 TRCN0000229455 TCTCCTTCCTGTGGGTTATAC pLKO_005 527 CDS 100% 13.200 9.240 N Hrh1 n/a
5 TRCN0000229454 TTTGGCTCTCTATGGATTATG pLKO_005 371 CDS 100% 13.200 9.240 N Hrh1 n/a
6 TRCN0000229456 GCCAAGCAGTTGGGTTGTATC pLKO_005 1309 CDS 100% 10.800 7.560 N Hrh1 n/a
7 TRCN0000028677 CCCATGAACATCCTCTATCTT pLKO.1 310 CDS 100% 5.625 3.938 N Hrh1 n/a
8 TRCN0000028668 CTGTGGGTTATACCTATACTT pLKO.1 535 CDS 100% 5.625 3.938 N Hrh1 n/a
9 TRCN0000028707 CCTGTGCACATGTTCACCATT pLKO.1 1411 CDS 100% 4.950 3.465 N Hrh1 n/a
10 TRCN0000028696 GCTGTGGTTCTATGTGAAGAT pLKO.1 684 CDS 100% 4.950 3.465 N Hrh1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3376 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.