Transcript: Human NM_001317224.2

Homo sapiens cadherin 10 (CDH10), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CDH10 (1008)
Length:
3432
CDS:
509..2869

Additional Resources:

NCBI RefSeq record:
NM_001317224.2
NBCI Gene record:
CDH10 (1008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425723 GACTCTTAACGTAGGATATAT pLKO_005 2861 CDS 100% 15.000 21.000 N CDH10 n/a
2 TRCN0000413314 TCTACGCGCACAAGCTATTAA pLKO_005 886 CDS 100% 15.000 21.000 N CDH10 n/a
3 TRCN0000054290 CGGTACTGATATGTTTGACAT pLKO.1 1444 CDS 100% 4.950 6.930 N CDH10 n/a
4 TRCN0000054291 CGGTTTAATAAGCTAGCAGAA pLKO.1 2813 CDS 100% 4.050 5.670 N CDH10 n/a
5 TRCN0000054289 CGGCGAGATATTATTCCAGAA pLKO.1 2561 CDS 100% 4.050 3.240 N CDH10 n/a
6 TRCN0000054292 CGAAGACTTTATACTCTGAAA pLKO.1 1529 CDS 100% 4.950 3.465 N CDH10 n/a
7 TRCN0000054288 GCACAATCATTGGTACTGTAA pLKO.1 1707 CDS 100% 4.950 3.465 N CDH10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.