Transcript: Human NM_001317227.1

Homo sapiens cadherin 12 (CDH12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
CDH12 (1010)
Length:
3714
CDS:
459..2843

Additional Resources:

NCBI RefSeq record:
NM_001317227.1
NBCI Gene record:
CDH12 (1010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433938 CTCTACACCATGGAGGTTTAT pLKO_005 1620 CDS 100% 13.200 9.240 N CDH12 n/a
2 TRCN0000055506 GCAGGCAGCAAGAGTTGTATT pLKO.1 2134 CDS 100% 13.200 9.240 N CDH12 n/a
3 TRCN0000436507 GACAACCTAGAACGAAGATAG pLKO_005 3158 3UTR 100% 10.800 7.560 N CDH12 n/a
4 TRCN0000055507 GCAGACATGTTTGGCGAAGAA pLKO.1 2793 CDS 100% 4.950 3.465 N CDH12 n/a
5 TRCN0000055504 GCGCAGTATAATTTCTCCATA pLKO.1 1815 CDS 100% 4.950 3.465 N CDH12 n/a
6 TRCN0000055505 GCTGGGCAACAATTCTCCTTT pLKO.1 2016 CDS 100% 4.950 3.465 N CDH12 n/a
7 TRCN0000055503 CGGTCACATTTCCAACGTGTT pLKO.1 594 CDS 100% 4.050 2.835 N CDH12 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2928 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.