Transcript: Mouse NM_001317353.1

Mus musculus lysosomal-associated membrane protein 1 (Lamp1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Lamp1 (16783)
Length:
2242
CDS:
229..1452

Additional Resources:

NCBI RefSeq record:
NM_001317353.1
NBCI Gene record:
Lamp1 (16783)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001317353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086786 GCGTTCAACATCAGCCCAAAT pLKO.1 967 CDS 100% 10.800 8.640 N Lamp1 n/a
2 TRCN0000332540 GCGTTCAACATCAGCCCAAAT pLKO_005 967 CDS 100% 10.800 8.640 N Lamp1 n/a
3 TRCN0000086784 GCAGTTCTTGTGGTAAAGAAA pLKO.1 443 CDS 100% 0.563 0.450 N Lamp1 n/a
4 TRCN0000332542 GCAGTTCTTGTGGTAAAGAAA pLKO_005 443 CDS 100% 0.563 0.450 N Lamp1 n/a
5 TRCN0000086785 CCCACTGTATCCAAGTACAAT pLKO.1 853 CDS 100% 5.625 3.938 N Lamp1 n/a
6 TRCN0000332472 CCCACTGTATCCAAGTACAAT pLKO_005 853 CDS 100% 5.625 3.938 N Lamp1 n/a
7 TRCN0000086787 CAAGTACAATGTTACTGGTAA pLKO.1 864 CDS 100% 4.950 3.465 N Lamp1 n/a
8 TRCN0000086783 GCAACATTTACTATGCACAAA pLKO.1 1586 3UTR 100% 4.950 3.465 N Lamp1 n/a
9 TRCN0000332543 GCAACATTTACTATGCACAAA pLKO_005 1586 3UTR 100% 4.950 3.465 N Lamp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.