Transcript: Mouse NM_001317723.1

Mus musculus tocopherol (alpha) transfer protein (Ttpa), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ttpa (50500)
Length:
2978
CDS:
108..737

Additional Resources:

NCBI RefSeq record:
NM_001317723.1
NBCI Gene record:
Ttpa (50500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001317723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105381 CCTAGAAGTATCCTTGGACTT pLKO.1 165 CDS 100% 4.050 5.670 N Ttpa n/a
2 TRCN0000105384 GACATTCTTCCTCGGGAATAT pLKO.1 615 CDS 100% 13.200 10.560 N Ttpa n/a
3 TRCN0000412941 GTAAATCCTACTCTAGCAAAT pLKO_005 1194 3UTR 100% 10.800 8.640 N Ttpa n/a
4 TRCN0000415140 CAATGGAGTTAAAGCTATATT pLKO_005 353 CDS 100% 15.000 10.500 N Ttpa n/a
5 TRCN0000105380 GCCTTCAACTTCTGGCATAAT pLKO.1 1754 3UTR 100% 13.200 9.240 N Ttpa n/a
6 TRCN0000428881 GAAAGTTCGTGGGATCCATTT pLKO_005 467 CDS 100% 10.800 7.560 N Ttpa n/a
7 TRCN0000105383 GAAGATTATCTCAGCAGCATT pLKO.1 699 CDS 100% 4.950 3.465 N Ttpa n/a
8 TRCN0000105382 GCTGTACTTACAGATTCCTTT pLKO.1 441 CDS 100% 4.950 3.465 N Ttpa n/a
9 TRCN0000060083 GCCAAGAAGATTGCTGCTGTA pLKO.1 426 CDS 100% 4.050 2.835 N TTPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.