Transcript: Human NM_001317990.2

Homo sapiens zinc finger and BTB domain containing 7A (ZBTB7A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
ZBTB7A (51341)
Length:
6319
CDS:
116..1870

Additional Resources:

NCBI RefSeq record:
NM_001317990.2
NBCI Gene record:
ZBTB7A (51341)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137891 GAACGTGTACGAGATCGACTT pLKO.1 331 CDS 100% 4.050 5.670 N ZBTB7A n/a
2 TRCN0000138142 GAAGCACTTTAAGGACGAGGA pLKO.1 1720 CDS 100% 2.160 3.024 N ZBTB7A n/a
3 TRCN0000136852 CCGTTTGCATATGCAATGCTA pLKO.1 3891 3UTR 100% 0.000 0.000 N ZBTB7A n/a
4 TRCN0000138671 GCCACTGAGACACAAACCTAT pLKO.1 2524 3UTR 100% 4.950 3.960 N ZBTB7A n/a
5 TRCN0000137332 GCTGGACCTTGTAGATCAAAT pLKO.1 541 CDS 100% 13.200 9.240 N ZBTB7A n/a
6 TRCN0000136851 CCACTGAGACACAAACCTATT pLKO.1 2525 3UTR 100% 10.800 7.560 N ZBTB7A n/a
7 TRCN0000271681 ACTACTACCTGAAGTACTTCA pLKO_005 1164 CDS 100% 4.950 3.465 N Zbtb7a n/a
8 TRCN0000136520 CCAGTACTTCAAGAAGCTGTT pLKO.1 283 CDS 100% 4.050 2.835 N ZBTB7A n/a
9 TRCN0000138519 CCAGGAGAAGCACTTTAAGGA pLKO.1 1714 CDS 100% 3.000 2.100 N ZBTB7A n/a
10 TRCN0000138084 GCAACGGCTTAGACTTCTATG pLKO.1 756 CDS 100% 10.800 6.480 N ZBTB7A n/a
11 TRCN0000137998 GCAGAAGGTGGAGAAGAAGAT pLKO.1 1222 CDS 100% 4.950 2.970 N ZBTB7A n/a
12 TRCN0000138716 GCCAGTACTTCAAGAAGCTGT pLKO.1 282 CDS 100% 2.640 1.584 N ZBTB7A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.