Transcript: Human NM_001318048.2

Homo sapiens laminin subunit beta 4 (LAMB4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
LAMB4 (22798)
Length:
2606
CDS:
87..2405

Additional Resources:

NCBI RefSeq record:
NM_001318048.2
NBCI Gene record:
LAMB4 (22798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154079 CCCATCTGTTTAGAACCAGAT pLKO.1 2109 CDS 100% 0.405 0.324 N LAMB4 n/a
2 TRCN0000153340 GCTCTGTACGAGATGATTGTT pLKO.1 849 CDS 100% 5.625 3.938 N LAMB4 n/a
3 TRCN0000154101 CCAGTGCCTTTGTAAAGAGAA pLKO.1 1349 CDS 100% 4.950 3.465 N LAMB4 n/a
4 TRCN0000153798 CCTGCTGCAATGTTAGTTGAA pLKO.1 498 CDS 100% 4.950 3.465 N LAMB4 n/a
5 TRCN0000152858 GCTGTCAACAACATTCCCTTT pLKO.1 1914 CDS 100% 4.050 2.835 N LAMB4 n/a
6 TRCN0000152524 GTGACTCCAAATACTCGGATA pLKO.1 634 CDS 100% 4.050 2.430 N LAMB4 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2423 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2423 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.