Transcript: Human NM_001318085.1

Homo sapiens SEC24 homolog B, COPII coat complex component (SEC24B), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
SEC24B (10427)
Length:
4753
CDS:
156..3959

Additional Resources:

NCBI RefSeq record:
NM_001318085.1
NBCI Gene record:
SEC24B (10427)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318085.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246103 ATGCTACAGCACCACTTATTT pLKO_005 1570 CDS 100% 15.000 21.000 N SEC24B n/a
2 TRCN0000246102 CCGATCCTGTCGAACGTATAT pLKO_005 1967 CDS 100% 13.200 18.480 N SEC24B n/a
3 TRCN0000065235 CGGCTGGATGATCGTGTATAT pLKO.1 3432 CDS 100% 13.200 18.480 N SEC24B n/a
4 TRCN0000065237 CGCGTATCCTAGTGTTTCATA pLKO.1 728 CDS 100% 5.625 7.875 N SEC24B n/a
5 TRCN0000065233 CCGGATAGTTTACTTGTGAAT pLKO.1 2415 CDS 100% 4.950 6.930 N SEC24B n/a
6 TRCN0000065234 GCGAACAACAACCCAACCATT pLKO.1 1008 CDS 100% 4.950 6.930 N SEC24B n/a
7 TRCN0000246106 TCATTGCAAGCTGGCAAATTT pLKO_005 4233 3UTR 100% 15.000 10.500 N SEC24B n/a
8 TRCN0000246104 ATGACCTTTGATAGCACTATT pLKO_005 2313 CDS 100% 13.200 9.240 N SEC24B n/a
9 TRCN0000246105 ATGCTGTTTCACCAAGTATAT pLKO_005 4161 3UTR 100% 13.200 9.240 N SEC24B n/a
10 TRCN0000065236 GCCCAGATTCATTTCGGTGTA pLKO.1 1819 CDS 100% 4.050 2.835 N SEC24B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318085.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.