Transcript: Human NM_001318146.1

Homo sapiens sorting nexin 33 (SNX33), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
SNX33 (257364)
Length:
3028
CDS:
97..1599

Additional Resources:

NCBI RefSeq record:
NM_001318146.1
NBCI Gene record:
SNX33 (257364)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318146.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161296 GCTGTCTCTGACCTATGTTTA pLKO.1 2819 3UTR 100% 13.200 18.480 N SNX33 n/a
2 TRCN0000161431 GTAACCTCAACCGTTTCTCAT pLKO.1 638 CDS 100% 4.950 6.930 N SNX33 n/a
3 TRCN0000164142 CCAAGCAAGTTAGGTACGCTT pLKO.1 2290 3UTR 100% 2.640 3.696 N SNX33 n/a
4 TRCN0000446958 GCCGTAACCTCAACCGTTTCT pLKO_005 635 CDS 100% 4.950 3.960 N SNX33 n/a
5 TRCN0000417298 TCTCAAACCAGGGTAGCTTTG pLKO_005 404 CDS 100% 6.000 4.200 N SNX33 n/a
6 TRCN0000161515 GCTGAGACATACTCCATTGAA pLKO.1 721 CDS 100% 5.625 3.938 N SNX33 n/a
7 TRCN0000161458 CAAGCACATGATGCAGAACTA pLKO.1 1500 CDS 100% 4.950 3.465 N SNX33 n/a
8 TRCN0000163158 GCTCGACTTCAAGCACATGAT pLKO.1 1491 CDS 100% 4.950 3.465 N SNX33 n/a
9 TRCN0000162401 CAAACACTTTGACTGGCTCTA pLKO.1 897 CDS 100% 4.050 2.430 N SNX33 n/a
10 TRCN0000093385 CGGCGCTACAAACACTTTGAT pLKO.1 889 CDS 100% 5.625 3.938 N Snx33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318146.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.