Transcript: Human NM_001318337.2

Homo sapiens FERM domain containing 4A (FRMD4A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
FRMD4A (55691)
Length:
6648
CDS:
98..3316

Additional Resources:

NCBI RefSeq record:
NM_001318337.2
NBCI Gene record:
FRMD4A (55691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318337.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144135 CCAGTATGACTACCATGATAA pLKO.1 919 CDS 100% 13.200 18.480 N FRMD4A n/a
2 TRCN0000422298 TCACCAAAGTACTGATGAATA pLKO_005 3295 CDS 100% 13.200 9.240 N FRMD4A n/a
3 TRCN0000426771 TCAGCTAGATCGAAGAGTATT pLKO_005 421 CDS 100% 13.200 9.240 N FRMD4A n/a
4 TRCN0000145502 GCAGAACTGAAGTTAGCTTAA pLKO.1 5087 3UTR 100% 10.800 7.560 N FRMD4A n/a
5 TRCN0000121701 CCCAAAGAAGATTCATGGATA pLKO.1 5605 3UTR 100% 4.950 3.465 N FRMD4A n/a
6 TRCN0000142828 CGTATCTGAATGCACTGAAGA pLKO.1 1692 CDS 100% 4.950 3.465 N FRMD4A n/a
7 TRCN0000143497 GCTGATCATAGACGATGGAAA pLKO.1 1786 CDS 100% 4.950 3.465 N FRMD4A n/a
8 TRCN0000142080 CTGGAACGAGAGTTTGCCATT pLKO.1 1589 CDS 100% 4.050 2.835 N FRMD4A n/a
9 TRCN0000142482 GCACCACATTTGTGTGCAGAT pLKO.1 4743 3UTR 100% 4.050 2.835 N FRMD4A n/a
10 TRCN0000142918 CCTGAAGGATAATGCTACCAT pLKO.1 520 CDS 100% 3.000 2.100 N FRMD4A n/a
11 TRCN0000122512 CGCCGATGTCAAGTACATCTT pLKO.1 254 CDS 100% 0.495 0.347 N FRMD4A n/a
12 TRCN0000419271 AGCGAAGTGGTGTTTGAATTA pLKO_005 599 CDS 100% 13.200 7.920 N FRMD4A n/a
13 TRCN0000143342 GCCAAGAGGAAGACATTCTTT pLKO.1 4052 3UTR 100% 5.625 3.375 N FRMD4A n/a
14 TRCN0000141074 CGACTATGACAAGTCACCCAT pLKO.1 1993 CDS 100% 2.640 1.584 N FRMD4A n/a
15 TRCN0000174607 GTTCACTATTATGCAGTGAAA pLKO.1 848 CDS 100% 0.495 0.347 N Frmd4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318337.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.