Transcript: Human NM_001318386.1

Homo sapiens tumor protein p53 inducible protein 11 (TP53I11), transcript variant 9, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
TP53I11 (9537)
Length:
3678
CDS:
573..1142

Additional Resources:

NCBI RefSeq record:
NM_001318386.1
NBCI Gene record:
TP53I11 (9537)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139326 CCTCACAGTGATACCTCCTTT pLKO.1 1384 3UTR 100% 4.950 6.930 N TP53I11 n/a
2 TRCN0000121543 CGTCATCAGCATTTACTACTA pLKO.1 1088 CDS 100% 4.950 6.930 N TP53I11 n/a
3 TRCN0000139920 GTTTACCATTCGGGAGCCTTT pLKO.1 731 CDS 100% 4.050 5.670 N TP53I11 n/a
4 TRCN0000140397 GCTGAGAAGGTCATCATTCGA pLKO.1 942 CDS 100% 3.000 4.200 N TP53I11 n/a
5 TRCN0000143672 GCTAAACTTGGCTTCCTTCTA pLKO.1 1592 3UTR 100% 4.950 3.960 N TP53I11 n/a
6 TRCN0000140224 GCTCACCGAAGCTTGCTATTT pLKO.1 971 CDS 100% 13.200 9.240 N TP53I11 n/a
7 TRCN0000140396 GATCATGTGGAACGCTCTCTA pLKO.1 917 CDS 100% 4.950 3.465 N TP53I11 n/a
8 TRCN0000140750 GCAGCTAAACTTGGCTTCCTT pLKO.1 1589 3UTR 100% 3.000 2.100 N TP53I11 n/a
9 TRCN0000122387 GCTGTGCTCTTCTCCGGCATT pLKO.1 780 CDS 100% 1.350 0.945 N TP53I11 n/a
10 TRCN0000139494 CCAAGCAGCTAAACTTGGCTT pLKO.1 1585 3UTR 100% 0.264 0.185 N TP53I11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.