Transcript: Human NM_001318477.1

Homo sapiens tsukushi, small leucine rich proteoglycan (TSKU), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-21
Taxon:
Homo sapiens (human)
Gene:
TSKU (25987)
Length:
3579
CDS:
985..2088

Additional Resources:

NCBI RefSeq record:
NM_001318477.1
NBCI Gene record:
TSKU (25987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005220 CCCGAGTAACTTATGTTCAAT pLKO.1 2144 3UTR 100% 5.625 7.875 N TSKU n/a
2 TRCN0000314859 CCCGAGTAACTTATGTTCAAT pLKO_005 2144 3UTR 100% 5.625 7.875 N TSKU n/a
3 TRCN0000005222 CGACGTGAACCTTAGCCACAA pLKO.1 1428 CDS 100% 4.050 5.670 N TSKU n/a
4 TRCN0000350392 CGACGTGAACCTTAGCCACAA pLKO_005 1428 CDS 100% 4.050 5.670 N TSKU n/a
5 TRCN0000314861 GGAACCCTCTAGCTGTCATTG pLKO_005 1667 CDS 100% 10.800 8.640 N TSKU n/a
6 TRCN0000314860 CCCACCATCTTGTGACAAATG pLKO_005 2074 CDS 100% 10.800 7.560 N TSKU n/a
7 TRCN0000005223 TCAGCCTGACTCGGGTGGATT pLKO.1 1136 CDS 100% 1.650 1.155 N TSKU n/a
8 TRCN0000005224 CCCAAGCTTAACTGGGCAGGA pLKO.1 1819 CDS 100% 0.720 0.504 N TSKU n/a
9 TRCN0000005221 GCTGGACCTTTCGGGCACCAA pLKO.1 1875 CDS 100% 0.000 0.000 N TSKU n/a
10 TRCN0000350393 GCTGGACCTTTCGGGCACCAA pLKO_005 1875 CDS 100% 0.000 0.000 N TSKU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.