Transcript: Human NM_001318918.1

Homo sapiens GLIS family zinc finger 2 (GLIS2), mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
GLIS2 (84662)
Length:
4486
CDS:
822..2396

Additional Resources:

NCBI RefSeq record:
NM_001318918.1
NBCI Gene record:
GLIS2 (84662)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107948 GACCATGTCAACGATTACCAT pLKO.1 1380 CDS 100% 3.000 4.200 N GLIS2 n/a
2 TRCN0000107945 CGGAAACTCTTCTGTGAAATA pLKO.1 2457 3UTR 100% 13.200 10.560 N GLIS2 n/a
3 TRCN0000433752 GGATGGTGCTAGGTCATTCAT pLKO_005 2529 3UTR 100% 5.625 3.938 N GLIS2 n/a
4 TRCN0000428287 ATGTGGACAAGCCCTACTACT pLKO_005 1684 CDS 100% 4.950 3.465 N GLIS2 n/a
5 TRCN0000082233 GCCAAGTGTAACCAGCTCTTT pLKO.1 1338 CDS 100% 4.950 3.465 N Glis2 n/a
6 TRCN0000301893 GCCAAGTGTAACCAGCTCTTT pLKO_005 1338 CDS 100% 4.950 3.465 N Glis2 n/a
7 TRCN0000107949 GCCTCTCAATCTGGCCAAGAA pLKO.1 2042 CDS 100% 4.950 3.465 N GLIS2 n/a
8 TRCN0000107947 CCGCACACACACCAACGAGAA pLKO.1 1499 CDS 100% 1.350 0.945 N GLIS2 n/a
9 TRCN0000107946 CCGAGGTTTCAACGCCAGGTA pLKO.1 1460 CDS 100% 0.880 0.616 N GLIS2 n/a
10 TRCN0000082234 GCCAGGTACAAGATGCTCATT pLKO.1 1473 CDS 100% 4.950 3.465 N Glis2 n/a
11 TRCN0000331777 GCCAGGTACAAGATGCTCATT pLKO_005 1473 CDS 100% 4.950 3.465 N Glis2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.