Transcript: Human NM_001319101.2

Homo sapiens centrosomal protein 68 (CEP68), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CEP68 (23177)
Length:
5392
CDS:
160..2022

Additional Resources:

NCBI RefSeq record:
NM_001319101.2
NBCI Gene record:
CEP68 (23177)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319101.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128696 CTATAGGCAAGCACCTTGATA pLKO.1 1436 CDS 100% 5.625 7.875 N CEP68 n/a
2 TRCN0000130399 GCTTGACTATACTTACCCACT pLKO.1 1065 CDS 100% 2.160 3.024 N CEP68 n/a
3 TRCN0000338784 GCTTGACTATACTTACCCACT pLKO_005 1065 CDS 100% 2.160 3.024 N CEP68 n/a
4 TRCN0000129429 GCACCCTCAAATCACCTACTA pLKO.1 1193 CDS 100% 4.950 3.960 N CEP68 n/a
5 TRCN0000130352 GCAGCTTTACCGGCAATTTAA pLKO.1 1743 CDS 100% 15.000 10.500 N CEP68 n/a
6 TRCN0000350995 ACCCTCAAATCACCTACTAAT pLKO_005 1195 CDS 100% 13.200 9.240 N CEP68 n/a
7 TRCN0000129360 GCTGATCTGCTGGCTGTATAA pLKO.1 1656 CDS 100% 13.200 9.240 N CEP68 n/a
8 TRCN0000129062 GAAGAGGAAGTGGAAAGTGAT pLKO.1 1576 CDS 100% 4.950 3.465 N CEP68 n/a
9 TRCN0000129139 GATGCTGATACCGAAGATGAT pLKO.1 601 CDS 100% 4.950 3.465 N CEP68 n/a
10 TRCN0000338722 GATGCTGATACCGAAGATGAT pLKO_005 601 CDS 100% 4.950 3.465 N CEP68 n/a
11 TRCN0000130472 GATTCTTCTTCAGTGCCTGTT pLKO.1 1818 CDS 100% 4.050 2.835 N CEP68 n/a
12 TRCN0000128481 GAAAGTGATGACGAGTATCTT pLKO.1 1588 CDS 100% 5.625 3.375 N CEP68 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3935 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319101.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.