Transcript: Human NM_001319182.2

Homo sapiens arginyl aminopeptidase (RNPEP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RNPEP (6051)
Length:
2089
CDS:
103..1662

Additional Resources:

NCBI RefSeq record:
NM_001319182.2
NBCI Gene record:
RNPEP (6051)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307289 ACCCGGACGACACCTATAATG pLKO_005 920 CDS 100% 13.200 10.560 N RNPEP n/a
2 TRCN0000294268 ATCAACTTCCTGGAGTTTATA pLKO_005 1744 3UTR 100% 15.000 10.500 N RNPEP n/a
3 TRCN0000294199 GGGAGAAGAGAGGTCCAAATA pLKO_005 338 CDS 100% 13.200 9.240 N RNPEP n/a
4 TRCN0000051728 CCTGCTGTTAAATACAAGTAT pLKO.1 262 CDS 100% 5.625 3.938 N RNPEP n/a
5 TRCN0000051730 GCTCCACAGCAATGTTGTCAA pLKO.1 1605 CDS 100% 4.950 3.465 N RNPEP n/a
6 TRCN0000051731 GCTCTTATTGAGGTCCCAGAT pLKO.1 286 CDS 100% 4.050 2.835 N RNPEP n/a
7 TRCN0000051732 GCTCAATGAAGGTTTCACCAT pLKO.1 744 CDS 100% 2.640 1.848 N RNPEP n/a
8 TRCN0000286915 GCTCAATGAAGGTTTCACCAT pLKO_005 744 CDS 100% 2.640 1.848 N RNPEP n/a
9 TRCN0000051729 CCTGGATAAGATCCTCCAGAA pLKO.1 1323 CDS 100% 0.405 0.284 N RNPEP n/a
10 TRCN0000294267 GGACTTCTACTTGGAATATTT pLKO_005 1077 CDS 100% 15.000 9.000 N RNPEP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.