Transcript: Human NM_001319214.1

Homo sapiens prolylcarboxypeptidase (PRCP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
PRCP (5547)
Length:
3308
CDS:
155..1330

Additional Resources:

NCBI RefSeq record:
NM_001319214.1
NBCI Gene record:
PRCP (5547)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050809 CGCCTGGTTTAGGATGAAATA pLKO.1 394 CDS 100% 13.200 9.240 N PRCP n/a
2 TRCN0000050808 GCCAGGTGAAATGCCTGAATA pLKO.1 855 CDS 100% 13.200 9.240 N PRCP n/a
3 TRCN0000323388 TTAGTACCTTGTGGTGTATTT pLKO_005 473 CDS 100% 13.200 9.240 N PRCP n/a
4 TRCN0000050811 GCTCCTTGGAAGTTAGACATA pLKO.1 1260 CDS 100% 4.950 3.465 N PRCP n/a
5 TRCN0000301030 GCTCCTTGGAAGTTAGACATA pLKO_005 1260 CDS 100% 4.950 3.465 N PRCP n/a
6 TRCN0000050810 CCCATTAACTTCTCAGGACAT pLKO.1 634 CDS 100% 4.050 2.835 N PRCP n/a
7 TRCN0000323311 CACCATCAGTGGCCCTCATAA pLKO_005 1566 3UTR 100% 13.200 7.920 N PRCP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.