Transcript: Human NM_001319840.2

Homo sapiens acetoacetyl-CoA synthetase (AACS), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
AACS (65985)
Length:
3133
CDS:
151..2046

Additional Resources:

NCBI RefSeq record:
NM_001319840.2
NBCI Gene record:
AACS (65985)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323392 AGATCGGGTTGTTGGTTATTT pLKO_005 609 CDS 100% 15.000 21.000 N AACS n/a
2 TRCN0000323316 CAAGTACAGGAAGGCGTATTT pLKO_005 1542 CDS 100% 13.200 18.480 N AACS n/a
3 TRCN0000323252 CATTGGTCCGTTGAGTCATAT pLKO_005 304 CDS 100% 13.200 9.240 N AACS n/a
4 TRCN0000323251 GCTCGGAAATCTATAACATTG pLKO_005 1685 CDS 100% 10.800 7.560 N AACS n/a
5 TRCN0000045416 GAACGATGAGAACGGCAACAA pLKO.1 1524 CDS 100% 4.950 3.465 N AACS n/a
6 TRCN0000045417 TGTGGACACATCGAAAGGAAT pLKO.1 390 CDS 100% 4.950 3.465 N AACS n/a
7 TRCN0000045415 CAGTAAGAAGAACACGCAGAT pLKO.1 216 CDS 100% 4.050 2.835 N AACS n/a
8 TRCN0000045414 GCTGTTGTCTATAATGGCAAA pLKO.1 775 CDS 100% 4.050 2.835 N AACS n/a
9 TRCN0000323253 TTGCTCTGTGAAGGTGCAAAT pLKO_005 2412 3UTR 100% 10.800 6.480 N AACS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.