Transcript: Human NM_001320032.2

Homo sapiens ATP binding cassette subfamily C member 5 (ABCC5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ABCC5 (10057)
Length:
5905
CDS:
1642..4539

Additional Resources:

NCBI RefSeq record:
NM_001320032.2
NBCI Gene record:
ABCC5 (10057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296477 AGGTTCAGGGAACCGTTATTA pLKO_005 4774 3UTR 100% 15.000 21.000 N ABCC5 n/a
2 TRCN0000308254 ATCACGGCTCACAGCATATTT pLKO_005 1118 5UTR 100% 15.000 21.000 N ABCC5 n/a
3 TRCN0000060303 CCCTTGGCATTCCTGGTTATT pLKO.1 2791 CDS 100% 13.200 18.480 N ABCC5 n/a
4 TRCN0000296525 CTAGGCTCCGATAGGATTATG pLKO_005 4399 CDS 100% 13.200 18.480 N ABCC5 n/a
5 TRCN0000060305 CCGCCACTGTAAGATTCTGAT pLKO.1 4260 CDS 100% 4.950 6.930 N ABCC5 n/a
6 TRCN0000060304 GCTTTGAAAGTAACACCGTTT pLKO.1 1446 5UTR 100% 4.050 5.670 N ABCC5 n/a
7 TRCN0000060306 CCCAAGGGAAAGTACCATCAT pLKO.1 339 5UTR 100% 4.950 3.960 N ABCC5 n/a
8 TRCN0000308256 CACCGCCAGTTGAGATCAATT pLKO_005 2591 CDS 100% 13.200 9.240 N ABCC5 n/a
9 TRCN0000060307 CCACATCTTCAATAGTGCTAT pLKO.1 2388 CDS 100% 4.950 2.970 N ABCC5 n/a
10 TRCN0000290031 CCACATCTTCAATAGTGCTAT pLKO_005 2388 CDS 100% 4.950 2.970 N ABCC5 n/a
11 TRCN0000111042 CGAAGGGTTGTGTGGATCTTT pLKO.1 612 5UTR 100% 5.625 4.500 N Abcc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.