Transcript: Human NM_001320041.1

Homo sapiens ELL associated factor 2 (EAF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
EAF2 (55840)
Length:
905
CDS:
360..752

Additional Resources:

NCBI RefSeq record:
NM_001320041.1
NBCI Gene record:
EAF2 (55840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414030 GAAGGCAGAAGCTAGTCTAAT pLKO_005 458 CDS 100% 13.200 18.480 N EAF2 n/a
2 TRCN0000005292 GTGACCATAACTCTGCCAAAT pLKO.1 281 5UTR 100% 10.800 15.120 N EAF2 n/a
3 TRCN0000005293 GCTATGACTTCAAACCTGCTT pLKO.1 210 5UTR 100% 2.640 3.696 N EAF2 n/a
4 TRCN0000430116 GCCTTCTGATGAATACTTTAA pLKO_005 685 CDS 100% 13.200 9.240 N EAF2 n/a
5 TRCN0000193208 CATCTTCAAGTAGTGAGGATA pLKO.1 526 CDS 100% 4.950 3.465 N Eaf2 n/a
6 TRCN0000005289 CCTGATATAGATGCCAGTCAT pLKO.1 642 CDS 100% 4.950 3.465 N EAF2 n/a
7 TRCN0000005291 GCAAATCCTCTACTTCTGATA pLKO.1 574 CDS 100% 4.950 3.465 N EAF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.