Transcript: Human NM_001320126.2

Homo sapiens abhydrolase domain containing 6 (ABHD6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
ABHD6 (57406)
Length:
2198
CDS:
216..1229

Additional Resources:

NCBI RefSeq record:
NM_001320126.2
NBCI Gene record:
ABHD6 (57406)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320126.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154639 CCGCATCCCTCATAACAACTT pLKO.1 920 CDS 100% 4.950 6.930 N ABHD6 n/a
2 TRCN0000312483 CCGCATCCCTCATAACAACTT pLKO_005 920 CDS 100% 4.950 6.930 N ABHD6 n/a
3 TRCN0000032796 CAGCACTGATAAGAATCTATT pLKO.1 310 CDS 100% 13.200 9.240 N Abhd6 n/a
4 TRCN0000155926 CCTGGCATTTGTGGCTTCATT pLKO.1 275 CDS 100% 5.625 3.938 N ABHD6 n/a
5 TRCN0000312491 CCTGGCATTTGTGGCTTCATT pLKO_005 275 CDS 100% 5.625 3.938 N ABHD6 n/a
6 TRCN0000152021 CATCCCTCATAACAACTTCTA pLKO.1 923 CDS 100% 4.950 3.465 N ABHD6 n/a
7 TRCN0000032797 CCTGCAGTACTCAACTGACAA pLKO.1 740 CDS 100% 4.950 3.465 N Abhd6 n/a
8 TRCN0000155569 CCTTCCAAAGAACCTGCACTT pLKO.1 494 CDS 100% 4.050 2.835 N ABHD6 n/a
9 TRCN0000349723 CCTTCCAAAGAACCTGCACTT pLKO_005 494 CDS 100% 4.050 2.835 N ABHD6 n/a
10 TRCN0000152339 CAACTTCTACCGAAAGTTGTT pLKO.1 935 CDS 100% 0.495 0.347 N ABHD6 n/a
11 TRCN0000151722 CCATGAAGTCTTCAAGTTCAT pLKO.1 1479 3UTR 100% 0.495 0.347 N ABHD6 n/a
12 TRCN0000312484 CCATGAAGTCTTCAAGTTCAT pLKO_005 1479 3UTR 100% 0.495 0.347 N ABHD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320126.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.