Transcript: Human NM_001320157.3

Homo sapiens neurexin 1 (NRXN1), transcript variant gamma2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NRXN1 (9378)
Length:
4062
CDS:
204..623

Additional Resources:

NCBI RefSeq record:
NM_001320157.3
NBCI Gene record:
NRXN1 (9378)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320157.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204076 GCTACCTATGATCCTGGATTT pLKO.1 999 3UTR 100% 10.800 15.120 N NRXN1 n/a
2 TRCN0000203688 CGCACGCATTCATAAAGCAAA pLKO.1 917 3UTR 100% 4.950 3.960 N NRXN1 n/a
3 TRCN0000186601 GCTGTTGTAAAGGAGAAACAA pLKO.1 540 CDS 100% 5.625 3.375 N NRXN1 n/a
4 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1823 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320157.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.