Transcript: Mouse NM_001320235.1

Mus musculus matrix metallopeptidase 23 (Mmp23), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Mmp23 (26561)
Length:
1310
CDS:
111..1244

Additional Resources:

NCBI RefSeq record:
NM_001320235.1
NBCI Gene record:
Mmp23 (26561)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001320235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221500 GCCTTTCGAATGTGGAGTGAT pLKO.1 462 CDS 100% 4.950 6.930 N Mmp23 n/a
2 TRCN0000352264 GCCTTTCGAATGTGGAGTGAT pLKO_005 462 CDS 100% 4.950 6.930 N Mmp23 n/a
3 TRCN0000221504 AGGGAAATGTAGATGCGCCAA pLKO.1 262 CDS 100% 2.160 3.024 N Mmp23 n/a
4 TRCN0000221503 CACACGCTACAGTTGGAAGAA pLKO.1 644 CDS 100% 4.950 3.465 N Mmp23 n/a
5 TRCN0000352266 CACACGCTACAGTTGGAAGAA pLKO_005 644 CDS 100% 4.950 3.465 N Mmp23 n/a
6 TRCN0000221501 CCAGAAGCTGTGATTTCTGTT pLKO.1 919 CDS 100% 0.495 0.347 N Mmp23 n/a
7 TRCN0000352267 CCAGAAGCTGTGATTTCTGTT pLKO_005 919 CDS 100% 0.495 0.347 N Mmp23 n/a
8 TRCN0000052207 CTGGGCCTGATGCACTCACAA pLKO.1 720 CDS 100% 1.650 0.990 N MMP23A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.