Transcript: Mouse NM_001320331.1

Mus musculus kallikrein 1 (Klk1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Klk1 (16612)
Length:
948
CDS:
120..761

Additional Resources:

NCBI RefSeq record:
NM_001320331.1
NBCI Gene record:
Klk1 (16612)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001320331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031339 GTCAAATATGAATACCCAGAT pLKO.1 606 CDS 100% 4.050 2.835 N Klk1 n/a
2 TRCN0000031341 GCAGCATTACACCCGTCAAAT pLKO.1 592 CDS 100% 13.200 7.920 N Klk1 n/a
3 TRCN0000417259 TCGAATTGTTGGAGGATTTAA pLKO_005 188 CDS 100% 15.000 7.500 Y Klk1b11 n/a
4 TRCN0000031343 CTCGAATTGTTGGAGGATTTA pLKO.1 187 CDS 100% 13.200 6.600 Y Klk1 n/a
5 TRCN0000031342 CCACTGCCATAATGACAAGTA pLKO.1 311 CDS 100% 4.950 2.475 Y Klk1 n/a
6 TRCN0000031340 CCTGAGGATGACTACAGCAAT pLKO.1 456 CDS 100% 4.950 2.475 Y Klk1 n/a
7 TRCN0000031306 CCTGCTGACATCACAGATGTT pLKO.1 504 CDS 100% 4.950 2.475 Y Klk1b1 n/a
8 TRCN0000032114 TGGAGGATTTAACTGTGAGAA pLKO.1 197 CDS 100% 4.950 2.475 Y Klk1b26 n/a
9 TRCN0000031747 CCACTGATCTGTGATGGTGTT pLKO.1 755 CDS 100% 4.050 2.025 Y Klk1b5 n/a
10 TRCN0000032026 CCCACTGATCTGTGATGGTAT pLKO.1 754 CDS 100% 4.950 2.475 Y Klk1b4 n/a
11 TRCN0000032118 CTTCAACATGAGCCTCCTGAT pLKO.1 419 CDS 100% 4.050 2.025 Y Klk1b26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.