Transcript: Human NM_001320571.2

Homo sapiens scaffold attachment factor B (SAFB), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
SAFB (6294)
Length:
2789
CDS:
323..2602

Additional Resources:

NCBI RefSeq record:
NM_001320571.2
NBCI Gene record:
SAFB (6294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431888 GGTGGTAATCCTGACGAAATT pLKO_005 328 CDS 100% 13.200 18.480 N SAFB n/a
2 TRCN0000022103 CGAAGATGACTCGGATACAAA pLKO.1 1006 CDS 100% 5.625 7.875 N SAFB n/a
3 TRCN0000022100 CGGACTGTAGTAATGGATAAA pLKO.1 1535 CDS 100% 13.200 10.560 N SAFB n/a
4 TRCN0000434945 AGAGGACAAAGAAACTATAAA pLKO_005 400 CDS 100% 15.000 10.500 N SAFB n/a
5 TRCN0000022101 CGCAGCAGTTGTGGTAGAAAT pLKO.1 1052 CDS 100% 13.200 9.240 N SAFB n/a
6 TRCN0000022099 GCGCTACCATTCTGACTTTAA pLKO.1 2050 CDS 100% 13.200 9.240 N SAFB n/a
7 TRCN0000241738 AGTCCTGGAGCTCGCTGTTAT pLKO_005 1178 CDS 100% 13.200 9.240 N Safb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.