Transcript: Mouse NM_001320725.1

Mus musculus predicted gene, 45935 (Gm45935), mRNA.

Source:
NCBI, updated 2017-03-15
Taxon:
Mus musculus (mouse)
Gene:
Gm45935 (107303348)
Length:
3895
CDS:
608..3583

Additional Resources:

NCBI RefSeq record:
NM_001320725.1
NBCI Gene record:
Gm45935 (107303348)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001320725.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367053 GAGCTTTGCTCAGCCTTAAAT pLKO_005 3686 3UTR 100% 15.000 7.500 Y Phf11b n/a
2 TRCN0000238916 TGGAGAATGTGCTGGATATAA pLKO_005 1537 CDS 100% 15.000 7.500 Y Setdb2 n/a
3 TRCN0000376129 CAAGAAGTAATCAAGAGTAAA pLKO_005 3407 CDS 100% 13.200 6.600 Y Phf11b n/a
4 TRCN0000238913 CCAAGCAATGAATCTAGTAAA pLKO_005 757 CDS 100% 13.200 6.600 Y Setdb2 n/a
5 TRCN0000238914 TCTGACGTGGATATTAGTAAT pLKO_005 1295 CDS 100% 13.200 6.600 Y Setdb2 n/a
6 TRCN0000238917 TGAGGGCTGCATAGACATAAA pLKO_005 1456 CDS 100% 13.200 6.600 Y Setdb2 n/a
7 TRCN0000085883 CTCAGCCTTAAATGGAATCTT pLKO.1 3694 3UTR 100% 5.625 2.813 Y Phf11d n/a
8 TRCN0000085848 TCAGCCTTAAATGGAATCTTA pLKO.1 3695 3UTR 100% 5.625 2.813 Y Phf11a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320725.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.