Transcript: Human NM_001320878.2

Homo sapiens sulfotransferase family 1C member 3 (SULT1C3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SULT1C3 (442038)
Length:
1244
CDS:
124..1038

Additional Resources:

NCBI RefSeq record:
NM_001320878.2
NBCI Gene record:
SULT1C3 (442038)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161132 CTAGATAGACACGCTTTCCTT pLKO.1 373 CDS 100% 3.000 4.200 N SULT1C3 n/a
2 TRCN0000161996 GATTGTCTATGTGGCCAGAAA pLKO.1 522 CDS 100% 4.950 3.465 N SULT1C3 n/a
3 TRCN0000160255 CCTCAGAACTTAGAGGAATTT pLKO.1 604 CDS 100% 13.200 7.920 N SULT1C3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.