Transcript: Human NM_001320941.2

Homo sapiens iron responsive element binding protein 2 (IREB2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
IREB2 (3658)
Length:
6254
CDS:
803..2944

Additional Resources:

NCBI RefSeq record:
NM_001320941.2
NBCI Gene record:
IREB2 (3658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438740 ACGGAGCTCGAAGAGGTAATG pLKO_005 2403 CDS 100% 10.800 15.120 N IREB2 n/a
2 TRCN0000056602 CCACCCTTAGTGGTAGCTTAT pLKO.1 1937 CDS 100% 10.800 15.120 N IREB2 n/a
3 TRCN0000056598 GCAGGAAGTATCGCTAGGAAT pLKO.1 2324 CDS 100% 4.950 6.930 N IREB2 n/a
4 TRCN0000114440 GTACGAAATTGTGATGGCTTT pLKO.1 270 5UTR 100% 4.050 5.670 N Ireb2 n/a
5 TRCN0000334352 GTACGAAATTGTGATGGCTTT pLKO_005 270 5UTR 100% 4.050 5.670 N Ireb2 n/a
6 TRCN0000429419 GAAGGTATCCCACTGATTATT pLKO_005 2561 CDS 100% 15.000 10.500 N IREB2 n/a
7 TRCN0000423746 GGCCATTGGAATCTCATTTAT pLKO_005 3379 3UTR 100% 15.000 10.500 N IREB2 n/a
8 TRCN0000423091 TATACGAATGGTGCTATTAAT pLKO_005 3124 3UTR 100% 15.000 10.500 N IREB2 n/a
9 TRCN0000056600 CCTCAGTTCAAGTGGAGTATT pLKO.1 1720 CDS 100% 13.200 9.240 N IREB2 n/a
10 TRCN0000415021 GCAAACATGTGTCCGGAATAT pLKO_005 1166 CDS 100% 13.200 9.240 N IREB2 n/a
11 TRCN0000430945 GGAAGCTGCTGTACGAAATTG pLKO_005 260 5UTR 100% 13.200 9.240 N IREB2 n/a
12 TRCN0000424711 TACTACTGTTTGTTGGTTTAA pLKO_005 3311 3UTR 100% 13.200 9.240 N IREB2 n/a
13 TRCN0000056599 GCTGGAAAGTTTGTTGAGTTT pLKO.1 1097 CDS 100% 4.950 3.465 N IREB2 n/a
14 TRCN0000056601 GCCCGTGTTCTTCTTCAAGAT pLKO.1 369 5UTR 100% 4.950 2.970 N IREB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.