Transcript: Human NM_001321039.2

Homo sapiens G protein signaling modulator 2 (GPSM2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
GPSM2 (29899)
Length:
5605
CDS:
493..2547

Additional Resources:

NCBI RefSeq record:
NM_001321039.2
NBCI Gene record:
GPSM2 (29899)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429252 TTAACCCTTGCAAGGACTATT pLKO_005 757 CDS 100% 13.200 18.480 N GPSM2 n/a
2 TRCN0000435981 TTGTCAGCGACACCTAGATAT pLKO_005 864 CDS 100% 13.200 18.480 N GPSM2 n/a
3 TRCN0000011025 GCATGATTATGCCAAAGCATT pLKO.1 717 CDS 100% 4.950 6.930 N GPSM2 n/a
4 TRCN0000414463 ATCCAGATTAGATGATCAAAG pLKO_005 2310 CDS 100% 10.800 7.560 N GPSM2 n/a
5 TRCN0000006469 GCAGATACTATTGGAGATGAA pLKO.1 1942 CDS 100% 4.950 3.465 N GPSM2 n/a
6 TRCN0000006468 GCACTTTACAATCTTGGGAAT pLKO.1 922 CDS 100% 4.050 2.835 N GPSM2 n/a
7 TRCN0000006470 CCTGATGACTAATGACAACAA pLKO.1 2244 CDS 100% 4.950 2.970 N GPSM2 n/a
8 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 3348 3UTR 100% 13.200 6.600 Y IQCC n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3281 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4275 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.