Transcript: Human NM_001321179.1

Homo sapiens family with sequence similarity 156 member B (FAM156B), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
FAM156B (727866)
Length:
3050
CDS:
1716..2357

Additional Resources:

NCBI RefSeq record:
NM_001321179.1
NBCI Gene record:
FAM156B (727866)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269729 TAGGTGACAGAAGTCAGAATC pLKO_005 2062 CDS 100% 10.800 5.400 Y FAM156B n/a
2 TRCN0000270295 TTCCGATGTGAATGTCGATAC pLKO_005 2085 CDS 100% 6.000 3.000 Y FAM156B n/a
3 TRCN0000269730 AGAGCCACAGGCCGAATCTTT pLKO_005 2110 CDS 100% 5.625 2.813 Y FAM156B n/a
4 TRCN0000162597 CAGAATCGATTCCGATGTGAA pLKO.1 2076 CDS 100% 4.950 2.475 Y FAM156A n/a
5 TRCN0000160816 CCTGAGATCCAGTTTCAAGAA pLKO.1 2818 3UTR 100% 4.950 2.475 Y FAM156A n/a
6 TRCN0000165032 GTACTCAGAACAGCCGATGAT pLKO.1 1817 CDS 100% 4.950 2.475 Y FAM156A n/a
7 TRCN0000160981 GTTTCAAGAATGGGCAGGTAA pLKO.1 2829 3UTR 100% 4.950 2.475 Y FAM156A n/a
8 TRCN0000269728 TACTCAGAACAGCCGATGATG pLKO_005 1818 CDS 100% 4.950 2.475 Y FAM156B n/a
9 TRCN0000269794 TGTCAGTAAGAGATCACATGT pLKO_005 2696 3UTR 100% 4.950 2.475 Y FAM156B n/a
10 TRCN0000166440 CCCATTAGGTGACAGAAGTCA pLKO.1 2057 CDS 100% 3.000 1.500 Y FAM156A n/a
11 TRCN0000161583 GTGACAGAAGTCAGAATCGAT pLKO.1 2065 CDS 100% 3.000 1.500 Y FAM156A n/a
12 TRCN0000165780 CGATTCCGATGTGAATGTCGA pLKO.1 2082 CDS 100% 2.640 1.320 Y FAM156A n/a
13 TRCN0000166640 CTCAAGCAGTGGTTAGAGGAA pLKO.1 2331 CDS 100% 2.640 1.320 Y FAM156A n/a
14 TRCN0000161011 GAAGTCAGAATCGATTCCGAT pLKO.1 2071 CDS 100% 2.640 1.320 Y FAM156A n/a
15 TRCN0000161420 GATTCCGATGTGAATGTCGAT pLKO.1 2083 CDS 100% 2.640 1.320 Y FAM156A n/a
16 TRCN0000165177 GTGAATGTCGATACTGCCAGA pLKO.1 2092 CDS 100% 2.160 1.080 Y FAM156A n/a
17 TRCN0000161839 GAGTTCCTTCAGAGGAAGAAA pLKO.1 1959 CDS 100% 0.563 0.281 Y FAM156A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.