Transcript: Human NM_001321383.1

Homo sapiens abhydrolase domain containing 11 (ABHD11), transcript variant 11, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
ABHD11 (83451)
Length:
2000
CDS:
71..580

Additional Resources:

NCBI RefSeq record:
NM_001321383.1
NBCI Gene record:
ABHD11 (83451)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050730 CGAGGCCGCTTCCGCTTTCCT pLKO.1 219 CDS 100% 0.000 0.000 N ABHD11 n/a
2 TRCN0000050732 TCCGCTTTCCTACAGGCTTCT pLKO.1 229 CDS 100% 4.050 2.835 N ABHD11 n/a
3 TRCN0000050729 CACGGGCTCTTCGGCAGCAAA pLKO.1 287 CDS 100% 0.000 0.000 N ABHD11 n/a
4 TRCN0000050728 CTTCAACTCCATCGCCAAGAT pLKO.1 313 CDS 100% 4.950 2.970 N ABHD11 n/a
5 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1652 3UTR 100% 4.950 2.475 Y ORAI2 n/a
6 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1649 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.