Transcript: Human NM_001321550.2

Homo sapiens potassium channel tetramerization domain containing 18 (KCTD18), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
KCTD18 (130535)
Length:
2917
CDS:
1122..1775

Additional Resources:

NCBI RefSeq record:
NM_001321550.2
NBCI Gene record:
KCTD18 (130535)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321550.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148636 CGGACGAAAGTGTGAACTATA pLKO.1 1282 CDS 100% 13.200 18.480 N KCTD18 n/a
2 TRCN0000130499 GCTTGTGTTATTGACCGTGAT pLKO.1 679 5UTR 100% 4.050 5.670 N KCTD18 n/a
3 TRCN0000149828 CCTTCCACAAGTACCCAAATT pLKO.1 1335 CDS 100% 13.200 9.240 N KCTD18 n/a
4 TRCN0000128284 GCACTTTGACTCTCACTTAAT pLKO.1 2329 3UTR 100% 13.200 9.240 N KCTD18 n/a
5 TRCN0000147702 GCCAATGAAATGGAGACATAT pLKO.1 838 5UTR 100% 13.200 9.240 N KCTD18 n/a
6 TRCN0000129279 CCCTTCCACAAGTACCCAAAT pLKO.1 1334 CDS 100% 10.800 7.560 N KCTD18 n/a
7 TRCN0000147144 CCACTGAAGATTCATTCTGAT pLKO.1 2577 3UTR 100% 4.950 3.465 N KCTD18 n/a
8 TRCN0000147418 GTTCAGTACATTTGGAGCTAT pLKO.1 1077 5UTR 100% 4.950 3.465 N KCTD18 n/a
9 TRCN0000148498 CCTGTACTATATCACAGCCAA pLKO.1 2194 3UTR 100% 2.640 1.848 N KCTD18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321550.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.