Transcript: Human NM_001321646.2

Homo sapiens trafficking protein particle complex 9 (TRAPPC9), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
TRAPPC9 (83696)
Length:
6872
CDS:
117..3536

Additional Resources:

NCBI RefSeq record:
NM_001321646.2
NBCI Gene record:
TRAPPC9 (83696)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321646.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118843 CGTTTGAACTTCGAGTTGAAA pLKO.1 1918 CDS 100% 5.625 7.875 N TRAPPC9 n/a
2 TRCN0000118844 CCGTTTGAACTTCGAGTTGAA pLKO.1 1917 CDS 100% 4.950 6.930 N TRAPPC9 n/a
3 TRCN0000118845 CCTCGAAAGTTCTCACCACTA pLKO.1 2344 CDS 100% 4.050 5.670 N TRAPPC9 n/a
4 TRCN0000427771 GGTGATGAAATATCTACTAAT pLKO_005 2232 CDS 100% 13.200 10.560 N TRAPPC9 n/a
5 TRCN0000436335 CGCAGACGACTGGAACGATTA pLKO_005 2041 CDS 100% 10.800 8.640 N TRAPPC9 n/a
6 TRCN0000428885 GAACTTCTTCAGGATCTATAA pLKO_005 203 CDS 100% 13.200 9.240 N TRAPPC9 n/a
7 TRCN0000118846 GCTTCTGTCATCTATCACTAT pLKO.1 870 CDS 100% 4.950 3.465 N TRAPPC9 n/a
8 TRCN0000118842 CCTTTGGCCATAGAAAGAAAT pLKO.1 3918 3UTR 100% 13.200 7.920 N TRAPPC9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321646.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.