Transcript: Human NM_001321707.2

Homo sapiens nuclear receptor coactivator 2 (NCOA2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
NCOA2 (10499)
Length:
8378
CDS:
134..4528

Additional Resources:

NCBI RefSeq record:
NM_001321707.2
NBCI Gene record:
NCOA2 (10499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244224 ATCCGTTCTCAGACTACTAAT pLKO_005 1199 CDS 100% 13.200 18.480 N Ncoa2 n/a
2 TRCN0000276447 ATCCGTTCTCAGACTACTAAT pLKO_005 1199 CDS 100% 13.200 18.480 N NCOA2 n/a
3 TRCN0000276395 CTTCGCTATTTGCTAGATAAA pLKO_005 2366 CDS 100% 13.200 18.480 N NCOA2 n/a
4 TRCN0000019640 CCAGGAATGATGGGTAATCAA pLKO.1 2882 CDS 100% 5.625 7.875 N NCOA2 n/a
5 TRCN0000019641 CCTGACAAATGTGCAATCTTA pLKO.1 332 CDS 100% 5.625 7.875 N NCOA2 n/a
6 TRCN0000019642 GCACAGGAAATAGCCATAGTT pLKO.1 1698 CDS 100% 5.625 4.500 N NCOA2 n/a
7 TRCN0000319400 GCACAGGAAATAGCCATAGTT pLKO_005 1698 CDS 100% 5.625 4.500 N NCOA2 n/a
8 TRCN0000276396 ATTCACCTTAGTGCAACTTAG pLKO_005 4767 3UTR 100% 10.800 7.560 N NCOA2 n/a
9 TRCN0000019643 GCTGCCTGGAATGGATATGAT pLKO.1 4471 CDS 100% 5.625 3.938 N NCOA2 n/a
10 TRCN0000019639 GCACTCTTGTTGCTGCACAAA pLKO.1 1164 CDS 100% 4.950 3.465 N NCOA2 n/a
11 TRCN0000319399 GCACTCTTGTTGCTGCACAAA pLKO_005 1164 CDS 100% 4.950 3.465 N NCOA2 n/a
12 TRCN0000096170 GCCATAGTTATACCAACAGTT pLKO.1 1710 CDS 100% 4.950 3.465 N Ncoa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.