Transcript: Human NM_001321776.2

Homo sapiens syntrophin gamma 1 (SNTG1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SNTG1 (54212)
Length:
2413
CDS:
928..2235

Additional Resources:

NCBI RefSeq record:
NM_001321776.2
NBCI Gene record:
SNTG1 (54212)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435518 GCTCATGTCTCTACAAGTTTC pLKO_005 1862 CDS 100% 10.800 15.120 N SNTG1 n/a
2 TRCN0000431329 GAGGAGCAGAACATAACATTC pLKO_005 1148 CDS 100% 10.800 7.560 N SNTG1 n/a
3 TRCN0000428026 GTGCTAGAAAGTCATCTAATG pLKO_005 2137 CDS 100% 10.800 7.560 N SNTG1 n/a
4 TRCN0000179836 CGGAACTTTCAGGACTACTTT pLKO.1 1205 CDS 100% 5.625 3.938 N SNTG1 n/a
5 TRCN0000180913 GCTGGAGAAGAAGTGACTCTA pLKO.1 1309 CDS 100% 4.950 3.465 N SNTG1 n/a
6 TRCN0000149807 GAGCCTTTCTATTCTGGTGAA pLKO.1 1072 CDS 100% 4.050 2.835 N SNTG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.